![]() Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3' Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3' Sample index sequencing primer (index2): 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -3' SI-PCR Primer: 5'- AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'Ĭell barcode sequencing primer (index1): 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' Truseq adapter (double stranded DNA with a T overhang): Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3' Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3' ISPCR: 5′- AAGCAGTGGTATCAACGCAGAGTACAT -3′ Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrGrG -3' This file is copied from Cell Ranger (using Cell Ranger v2.1.0 as an example) /path/to/cellranger-2.1.0/cellranger-cs/2.1.0/tenkit/lib/python/tenkit/barcodes.īeads-oligo-dT: |-5'- CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (T) 30VN -3' You can find out all the cell barcodes (14 bp) here: 737K-april-2014_rc.txt.gz. Based on their the v1 manual PDF and actual data, I think the information in this page is accurate. I cannot find the exact sequence information from the 10x website, so sequences shown here is based on educational guess. The Chromium Single Cell 3’ Solution v1 chemistry is obsolete and superseded by the v2 chemistry. To process the samples appropriately, users need to add the oligonucleotide sequence used for each sample to the sample submission form they deliver to the IGL.10x Chromium Single Cell 3' Solution v1 10x Chromium Single Cell 3' Solution v1 The IGL is able to complete the libraries for these protocols. It is the responsibility of each user to select their tagging method, to treat their cells, and to mix them prior to delivery to the IGL for processing. Cells that have hashtags are identified informatically after alignment to the reference genome. Details on each of these are available from the appropriate vendor. Alternatively, a lipid-based oligonucleotide tagging system is available from 10x Genomics. Oligonucleotide-antibody conjugates are available for this from external vendors, for example, BioLegend (TotalSeq A and B). It is possible to combine these samples into one library by tagging the cells in each sample with a unique identifier. Occasionally users may have a set of samples that individually have fewer than 10,000 cells each, but that can add up to 10,000 cells (so, for example, sample A has 2000 cells, sample B has 3000 cells, and sample C has 5000 cells). Generally, most users will assay 10,000 cells from one sample. The standard 10x Genomics recommendation for the library preparation protocol is that the maximum number of cells per library is 10,000. See below for more information on services and the 10x Genomics workflow in the IGL. The MPSSR also accepts cDNAs from users and can finish the library preparation for them, and can prepare hashtag and CITE-seq libraries. Training on the Chromium Controller is provided through the GPSR following which researchers can schedule use of the Chromium system for their direct use. If you prefer to prepare your own single cell DNA and libraries, the IGL Chromium platform is available for Shared Access use once you have received training from a member of the IGL. 10x Genomics library preparation and sequencing is performed through the Massively Parallel Sequencing Shared Resource.įor a Full Service 10x Genomics single cell analysis project from sample submission through sequencing, please go to the MPSSR iLab page to request a project. The Gene Profiling Shared Resource maintains the Chromium Controller system and provides support for preparation of single cell cDNA and gDNA for 10x Genomics applications. The Integrated Genomics Lab (IGL) provides support for single cell and nuclei DNA preparation and sequencing using the 10x Genomics Chromium single cell platform.
0 Comments
Leave a Reply. |